View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11247_low_26 (Length: 249)
Name: NF11247_low_26
Description: NF11247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11247_low_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 18 - 182
Target Start/End: Original strand, 3256074 - 3256242
Alignment:
| Q |
18 |
ctaaaaccacaatataaaatatta----tattttttattagtttcctataaataaaacctatgatcattagataccgctgctataatttacttnnnnnnn |
113 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3256074 |
ctaaaacaacaatataaaatattaataatattttttattagtttcctataaataaaacctatgatcattagataccgctgctataatttacttaaaaaaa |
3256173 |
T |
|
| Q |
114 |
ttagctgcagaaataacaaatacctagttgtttgaagtgaatcatccaattattaaagcatgttggttt |
182 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3256174 |
ttagctgcagaaatcacaaatacctagttgtttgaagtgaatcatccaattattaaagcatgttggttt |
3256242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University