View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11248_low_10 (Length: 273)
Name: NF11248_low_10
Description: NF11248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11248_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 9 - 255
Target Start/End: Original strand, 41033643 - 41033889
Alignment:
| Q |
9 |
agcagagagcctatatgaggtagttacaaaggaagaccctaagaagcaaggaacctacaccgctgttgatgcatgtggaaaacaagcaagaatgctttat |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41033643 |
agcagaaagcctatatgaggtagttacaaaggaagaccctaagaagcaaggaacctacaccgctgttgatgcatgtggaaaacaagcaagaatgctttat |
41033742 |
T |
|
| Q |
109 |
aactcaactagttacaaagatgagttggcttggggagctacttggttgtttcttgctactaaaaacactgattatcttgcaaatgcaactcaannnnnnn |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41033743 |
aactcaactagttacaaagatgagttggcttggggagctacttggttgtttcttgctactaaaaacactgattatcttgcaaatgcaactcaattttttt |
41033842 |
T |
|
| Q |
209 |
natcagcaaagaaagatgaaacaaatttagacaatggggtgttttat |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41033843 |
tatcagcaaagaaagatgaaacaaatttagacaaaggggtgttttat |
41033889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University