View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11248_low_16 (Length: 233)
Name: NF11248_low_16
Description: NF11248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11248_low_16 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 11 - 233
Target Start/End: Original strand, 10970935 - 10971171
Alignment:
| Q |
11 |
cacagaaaaacacaaacacacagactacagaattattgacgaacaacttcgtagcatagcaccgacacttctgattgaaggcgtatctggtgtac----- |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10970935 |
cacagaaaaacacaaacacacagactacagaattattgacgaacaacttcgtagcatagcaccgacacttctgattgaaggcgtatctggtgtacgtgtt |
10971034 |
T |
 |
| Q |
106 |
---------atcaaacggcaccgacacattgaatttatcgtttcctcgactatcattggtgttaaagtgtcagtgtccggtttccatcatataaattaaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10971035 |
agtgtccacatcaaacggcaccgacacattgaatttatcgtttcctcgactattatcggtgttaaagtgtcagtgtccggtttccatcatataaattaaa |
10971134 |
T |
 |
| Q |
197 |
cggtaagcagtaacacagaataattgttgataccttt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10971135 |
cggtaagcagtaacacagaataattgttgataccttt |
10971171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 65 - 103
Target Start/End: Complemental strand, 29647438 - 29647400
Alignment:
| Q |
65 |
catagcaccgacacttctgattgaaggcgtatctggtgt |
103 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
29647438 |
catagcaccgacacttctgattgaagacgtgtctggtgt |
29647400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University