View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11248_low_17 (Length: 213)
Name: NF11248_low_17
Description: NF11248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11248_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 17 - 200
Target Start/End: Original strand, 45478809 - 45478992
Alignment:
| Q |
17 |
catgttcgaaggcattgttttcgtacattggtactgctgaatagaatacaagttaatgtagtttgctgttaaagatagtccaattattgttaattaattt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45478809 |
catgttcgaaggcattgttttcgtacattggtactgctgaatagaatacaagttaatgtagtttgctgttaaagatagtccaattattgttaattaattt |
45478908 |
T |
 |
| Q |
117 |
atgtgtatatactattactatttagtgattttgactctagattttactaatcaaagaaaatttattgttgtgtagttctctgct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45478909 |
atgtgtatatactattactatttagtgattttgactctagattttactaatcaaagaaaatttattgttgtgtagttctttgct |
45478992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University