View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11248_low_5 (Length: 412)
Name: NF11248_low_5
Description: NF11248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11248_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 15 - 396
Target Start/End: Complemental strand, 32207503 - 32207122
Alignment:
| Q |
15 |
gagaagcaggctcaacatgaactagcgatgaagatttctaactatgcaaatgcagttttattggcattaaaggtgatattccttaagatatttctattcc |
114 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
32207503 |
gagaagcgggctcaacatgaactagcgatgaagatttcaaactatgcaaatgcagttttattggcattaaaggtgatattcctaaagatgtttatattct |
32207404 |
T |
|
| Q |
115 |
tttgaacatactttcttaccttgcaacatgtaaataacaatatgcatatacatatctagatttatgtgacacttaggactggatctatggctattgctgc |
214 |
Q |
| |
|
|||||||||||| |||| ||||||||| ||||||||||||||||||||||| ||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
32207403 |
cttgaacatacttgcttatcttgcaacagttaaataacaatatgcatatacatgtctagatttatgtgacaatcaggactggatctatggctattgctgc |
32207304 |
T |
|
| Q |
215 |
ttcaacattggattctctgcttgacttcatggctggtggcatactttggttcactcacatttcaatgaagaccataaatatgtacaaataccctattgga |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32207303 |
ttcaacattggattctctgcttgacttcatggccggtggcatactttggttcactcacatgtcaatgaagaccgtaaatatgtacaaataccctattgga |
32207204 |
T |
|
| Q |
315 |
aagttgagaatgcagccggtgggaataattatctttgcagctgttatggcaacacttggtgtgtccaaatctctttatctat |
396 |
Q |
| |
|
||| |||||||||| || || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32207203 |
aagctgagaatgcaacctgtaggaataattatctttgcagctgttatggcaacacttggtgtgtccaaatctctttatctat |
32207122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 189 - 375
Target Start/End: Complemental strand, 28296370 - 28296184
Alignment:
| Q |
189 |
aggactggatctatggctattgctgcttcaacattggattctctgcttgacttcatggctggtggcatactttggttcactcacatttcaatgaagacca |
288 |
Q |
| |
|
|||| ||||||||| |||||||| || ||||| ||||||||||||||||| | ||||||||||| |||||||||| ||||||||| ||||||||| || |
|
|
| T |
28296370 |
aggagtggatctatagctattgcagcatcaactttggattctctgcttgatctaatggctggtggtatactttggtacactcacatagcaatgaagaaca |
28296271 |
T |
|
| Q |
289 |
taaatatgtacaaataccctattggaaagttgagaatgcagccggtgggaataattatctttgcagctgttatggcaacacttggtg |
375 |
Q |
| |
|
||||||| || | || || || |||||| |||| ||||||| || || |||||| | ||||| ||||| ||||| |||||||||| |
|
|
| T |
28296270 |
taaatatctatcagtatcccatcggaaagctgagggtgcagccagtaggcataattgtttttgctgctgtcatggccacacttggtg |
28296184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University