View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11249_low_4 (Length: 303)
Name: NF11249_low_4
Description: NF11249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11249_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 35 - 145
Target Start/End: Complemental strand, 8172759 - 8172649
Alignment:
| Q |
35 |
cctctaacttttgctatacgatgatagccaaatcttatccaaaaaatattctctgcatactatattttgtccatatatacacaaattgcaagaatcagaa |
134 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8172759 |
cctctaacttttgctatatgatgatagccaaatcttatccaaaaaatattctctgcatactatattttgtccatatatacacaaattgcaagaatcagaa |
8172660 |
T |
 |
| Q |
135 |
agatatttttc |
145 |
Q |
| |
|
| ||||||||| |
|
|
| T |
8172659 |
atatatttttc |
8172649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 240 - 302
Target Start/End: Complemental strand, 8172621 - 8172559
Alignment:
| Q |
240 |
tagacccacatagatcaatcattgtaagtctaactacacacttttggtatttatataccaaaa |
302 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||| | || ||||||||| |
|
|
| T |
8172621 |
tagacccacatagatcaatcattctaagtctaaccacacacttttggtgtataaataccaaaa |
8172559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University