View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1124_high_18 (Length: 253)
Name: NF1124_high_18
Description: NF1124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1124_high_18 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 29 - 253
Target Start/End: Original strand, 24208860 - 24209085
Alignment:
| Q |
29 |
aaccaattcatattcaattttacttaaatatgtaactcttcctcagtgttgaaaatcagttagttcgaagtccttatcccttaaaccatttgttcttatg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24208860 |
aaccaattcatattcaattttacttaaatatgtaactcttcctcagtgttgaaaatcagttagttcgaagtccttatcccttaaaccatttgttcttatg |
24208959 |
T |
|
| Q |
129 |
ggttcacc-ttggagataaatgatcagacaacaacaattaactgccccttccatgggcaatgcatttttgtgaataaataatgatttttgttcgtgtaat |
227 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |||| |||||||||||| ||||| |
|
|
| T |
24208960 |
ggttcaccgttggagataaatgatctgacaacaacaattaactgccccttccatgggcaatgtgtttttgtgaatagataaggatttttgttcgggtaat |
24209059 |
T |
|
| Q |
228 |
gttgccattaagcttggttctttttc |
253 |
Q |
| |
|
|||||||||||| ||||||||||||| |
|
|
| T |
24209060 |
gttgccattaagtttggttctttttc |
24209085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University