View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1124_high_19 (Length: 252)
Name: NF1124_high_19
Description: NF1124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1124_high_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 9502544 - 9502302
Alignment:
| Q |
1 |
accatacgatagaggtcgctgttgttgttgataatgcttcacctgcaaataataaacaatgaaataatatgagacgcactgtcctcaacgattttccttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || |
|
|
| T |
9502544 |
accatacgatagaggtcgctgttgttgttgataatgcttcacctgcaaataataaacaatgaaataatatgagacgcactgtcctcaaggattttccgtg |
9502445 |
T |
|
| Q |
101 |
tataataagctaacaacaaca---gtgtacctctccgttttgcttggacagctgatcatcttcctccgatgatgacgaagttgctaacgacaacgatatc |
197 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
9502444 |
tataataagctaacaacaacaacagtgtacctctccgttttgcttggacagctgatcatcttcctcagatgatgatgaagttgctaacgacaacgatatc |
9502345 |
T |
|
| Q |
198 |
tcaaccgattcatgaatctctcgtcgcgcattctccgttttca |
240 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9502344 |
tcaacagattcatgaatctctcgtcgcgcattctccgttttca |
9502302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University