View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1124_high_8 (Length: 406)
Name: NF1124_high_8
Description: NF1124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1124_high_8 |
 |  |
|
| [»] scaffold0034 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 378
Target Start/End: Complemental strand, 41203643 - 41203283
Alignment:
| Q |
1 |
ttttctttttgcaaatgactcagttattatggga-cgaatgtagtagnnnnnnnnataaattttataaaacttgtaaagtgatcggtatataaacttttt |
99 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41203643 |
ttttttttttgcaaatgactcagttattatgggaacggatgtagtagttttttt-ataaattttataaaacttgtaaagtgatcggtatataaacttttt |
41203545 |
T |
 |
| Q |
100 |
caatccgtatctcttttcaacgtgaacttgattttttccaataataagttaatgtcgaccattttgcaagttaacaaattactgatgtccaagacttata |
199 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
41203544 |
caa-----------------cgtgaacttgattttttccaataataagttaatgtcgaccattttgcaagttaacgaattactgatgtccaagacttaca |
41203462 |
T |
 |
| Q |
200 |
agttctgtataggacataattgtagtaatacgccacacaataatttaatgttagaagttatggaacacaagtgtttctttgctaaattttgcagatgaat |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41203461 |
agttctgtataggacataattgtagtaatacgccacacaataatttaatgttagaagttatggaacacaagtgtttctttgctaaattttgcagatgaat |
41203362 |
T |
 |
| Q |
300 |
tctttaaagaagaagccgaagaatgcaggaacgccaggttgctttggcaattggaaactactaattccaagcttcttaa |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41203361 |
tctttaaagaagaagccgaagaatgcaggaacgccaggttgctttggcaattggaaactactaattccaagcttcttaa |
41203283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 6 - 36
Target Start/End: Original strand, 20964467 - 20964497
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatgggacg |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
20964467 |
tttttgcaaatgactcagttattatgggacg |
20964497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 6 - 35
Target Start/End: Complemental strand, 18509776 - 18509747
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatgggac |
35 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18509776 |
tttttgcaaatgactcagttattatgggac |
18509747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 34020974 - 34020938
Alignment:
| Q |
1 |
ttttctttttgcaaatgactcagttattatgggacga |
37 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
34020974 |
ttttttttttgcaaatgactcggttattatgggacga |
34020938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 6 - 34
Target Start/End: Complemental strand, 53848267 - 53848239
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatggga |
34 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
53848267 |
tttttgcaaatgactcagttattatggga |
53848239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 6 - 38
Target Start/End: Original strand, 37541291 - 37541323
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatgggacgaa |
38 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37541291 |
tttttgcaaatgactcagttattatgggacgaa |
37541323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 6 - 36
Target Start/End: Complemental strand, 2886105 - 2886075
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatgggacg |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2886105 |
tttttgcaaatgactcagttattatgggacg |
2886075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 6 - 36
Target Start/End: Complemental strand, 8773172 - 8773142
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatgggacg |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8773172 |
tttttgcaaatgactcagttattatgggacg |
8773142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 13 - 45
Target Start/End: Original strand, 7785418 - 7785450
Alignment:
| Q |
13 |
aaatgactcagttattatgggacgaatgtagta |
45 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
7785418 |
aaatgactcagttattatgggacgaatgaagta |
7785450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000009; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 6 - 45
Target Start/End: Original strand, 32967450 - 32967489
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatgggacgaatgtagta |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
32967450 |
tttttgcaaatgactcagttattatgggacggatggagta |
32967489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 6 - 36
Target Start/End: Complemental strand, 2195402 - 2195372
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatgggacg |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2195402 |
tttttgcaaatgactcagttattatgggacg |
2195372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 6 - 36
Target Start/End: Original strand, 10729093 - 10729123
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatgggacg |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10729093 |
tttttgcaaatgactcagttattatgggacg |
10729123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 6 - 36
Target Start/End: Complemental strand, 14689894 - 14689864
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatgggacg |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14689894 |
tttttgcaaatgactcagttattatgggacg |
14689864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 6 - 36
Target Start/End: Original strand, 38252611 - 38252641
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatgggacg |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38252611 |
tttttgcaaatgactcagttattatgggacg |
38252641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000009; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 31581617 - 31581652
Alignment:
| Q |
1 |
ttttctttttgcaaatgactcagttattatgggacg |
36 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31581617 |
ttttttttttgcaaatgactcagttattatgggacg |
31581652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 6 - 36
Target Start/End: Original strand, 37496570 - 37496600
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatgggacg |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37496570 |
tttttgcaaatgactcagttattatgggacg |
37496600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000009; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 9755308 - 9755343
Alignment:
| Q |
1 |
ttttctttttgcaaatgactcagttattatgggacg |
36 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9755308 |
ttttttttttgcaaatgactcagttattatgggacg |
9755343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 34915979 - 34916014
Alignment:
| Q |
1 |
ttttctttttgcaaatgactcagttattatgggacg |
36 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34915979 |
ttttttttttgcaaatgactcagttattatgggacg |
34916014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0034 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0034
Description:
Target: scaffold0034; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 6 - 36
Target Start/End: Complemental strand, 97993 - 97963
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatgggacg |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
97993 |
tttttgcaaatgactcagttattatgggacg |
97963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000004; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 6 - 36
Target Start/End: Original strand, 1334948 - 1334978
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatgggacg |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1334948 |
tttttgcaaatgactcagttattatgggacg |
1334978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 6 - 36
Target Start/End: Original strand, 38600978 - 38601008
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatgggacg |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38600978 |
tttttgcaaatgactcagttattatgggacg |
38601008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 32023268 - 32023305
Alignment:
| Q |
1 |
ttttctttttgcaaatgactcagttattatgggacgaa |
38 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
32023268 |
ttttttttttgcaattgactcagttattatgggacgaa |
32023305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000004; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 6 - 36
Target Start/End: Complemental strand, 314369 - 314339
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatgggacg |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
314369 |
tttttgcaaatgactcagttattatgggacg |
314339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 6 - 36
Target Start/End: Complemental strand, 2427291 - 2427261
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatgggacg |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2427291 |
tttttgcaaatgactcagttattatgggacg |
2427261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 6 - 36
Target Start/End: Complemental strand, 13222003 - 13221973
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatgggacg |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13222003 |
tttttgcaaatgactcagttattatgggacg |
13221973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 6 - 36
Target Start/End: Original strand, 20696954 - 20696984
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatgggacg |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
20696954 |
tttttgcaaatgactcagttattatgggacg |
20696984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 6 - 35
Target Start/End: Complemental strand, 40964987 - 40964958
Alignment:
| Q |
6 |
tttttgcaaatgactcagttattatgggac |
35 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40964987 |
tttttgcaaatgactcagttattatgggac |
40964958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 43077895 - 43077939
Alignment:
| Q |
1 |
ttttctttttgcaaatgactcagttattatgggacgaatgtagta |
45 |
Q |
| |
|
|||| |||||||||||| ||||||| |||||||||| |||||||| |
|
|
| T |
43077895 |
ttttttttttgcaaatggctcagttgttatgggacggatgtagta |
43077939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 7 - 36
Target Start/End: Original strand, 4044652 - 4044681
Alignment:
| Q |
7 |
ttttgcaaatgactcagttattatgggacg |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4044652 |
ttttgcaaatgactcagttattatgggacg |
4044681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 25814299 - 25814255
Alignment:
| Q |
1 |
ttttctttttgcaaatgactcagttattatgggacgaatgtagta |
45 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
25814299 |
ttttttttttgcaaatgtctcagttattatgggacggatggagta |
25814255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University