View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1124_low_25 (Length: 304)
Name: NF1124_low_25
Description: NF1124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1124_low_25 |
 |  |
|
| [»] scaffold0179 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 30 - 143
Target Start/End: Complemental strand, 895093 - 894980
Alignment:
| Q |
30 |
tgattatgggttaattgtatgcggtttgcatttatatagaaagttttgtgtttttgcgtatggctctatgtatgtaagtttcgattttccatatgtcttt |
129 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
895093 |
tgattatgggttaattgtatgcagtttgcatttatatagaaagttttgtgtttttgcgtatggctctatgtatgtaagtttcgatttttcatatgtcttt |
894994 |
T |
 |
| Q |
130 |
tatgaatatgatcg |
143 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
894993 |
tatgaatatgatcg |
894980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 178 - 224
Target Start/End: Complemental strand, 894954 - 894908
Alignment:
| Q |
178 |
gtggagattgacctacaacgtgacttgaaatatggggatttacaacc |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
894954 |
gtggagattgacctacaacgtgacttgaaatatggggatttacaacc |
894908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 2)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 30 - 87
Target Start/End: Original strand, 5315 - 5372
Alignment:
| Q |
30 |
tgattatgggttaattgtatgcggtttgcatttatatagaaagttttgtgtttttgcg |
87 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||| ||||| |||||||||| |
|
|
| T |
5315 |
tgattatgagttaattgtatgcagtttgcatttatatagaatgttttttgtttttgcg |
5372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 178 - 224
Target Start/End: Original strand, 5408 - 5454
Alignment:
| Q |
178 |
gtggagattgacctacaacgtgacttgaaatatggggatttacaacc |
224 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
5408 |
gtggagattgacttacaacgtggcttgaaatatggggatttacaacc |
5454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University