View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1124_low_25 (Length: 304)

Name: NF1124_low_25
Description: NF1124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1124_low_25
NF1124_low_25
[»] chr6 (2 HSPs)
chr6 (30-143)||(894980-895093)
chr6 (178-224)||(894908-894954)
[»] scaffold0179 (2 HSPs)
scaffold0179 (30-87)||(5315-5372)
scaffold0179 (178-224)||(5408-5454)


Alignment Details
Target: chr6 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 30 - 143
Target Start/End: Complemental strand, 895093 - 894980
Alignment:
30 tgattatgggttaattgtatgcggtttgcatttatatagaaagttttgtgtttttgcgtatggctctatgtatgtaagtttcgattttccatatgtcttt 129  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
895093 tgattatgggttaattgtatgcagtttgcatttatatagaaagttttgtgtttttgcgtatggctctatgtatgtaagtttcgatttttcatatgtcttt 894994  T
130 tatgaatatgatcg 143  Q
    ||||||||||||||    
894993 tatgaatatgatcg 894980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 178 - 224
Target Start/End: Complemental strand, 894954 - 894908
Alignment:
178 gtggagattgacctacaacgtgacttgaaatatggggatttacaacc 224  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
894954 gtggagattgacctacaacgtgacttgaaatatggggatttacaacc 894908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 2)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 30 - 87
Target Start/End: Original strand, 5315 - 5372
Alignment:
30 tgattatgggttaattgtatgcggtttgcatttatatagaaagttttgtgtttttgcg 87  Q
    |||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||    
5315 tgattatgagttaattgtatgcagtttgcatttatatagaatgttttttgtttttgcg 5372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 178 - 224
Target Start/End: Original strand, 5408 - 5454
Alignment:
178 gtggagattgacctacaacgtgacttgaaatatggggatttacaacc 224  Q
    |||||||||||| ||||||||| ||||||||||||||||||||||||    
5408 gtggagattgacttacaacgtggcttgaaatatggggatttacaacc 5454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University