View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11250_high_10 (Length: 269)

Name: NF11250_high_10
Description: NF11250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11250_high_10
NF11250_high_10
[»] chr3 (1 HSPs)
chr3 (218-257)||(39484095-39484134)


Alignment Details
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 218 - 257
Target Start/End: Complemental strand, 39484134 - 39484095
Alignment:
218 aatgtcgttgttttctacagaatttccccatttggtttct 257  Q
    ||||||||||||||||||||||||||||||||||||||||    
39484134 aatgtcgttgttttctacagaatttccccatttggtttct 39484095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University