View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11251_high_8 (Length: 263)
Name: NF11251_high_8
Description: NF11251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11251_high_8 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 11 - 263
Target Start/End: Complemental strand, 12022298 - 12022046
Alignment:
| Q |
11 |
cacagagggaaaatcaagttcattttctggatgcaacagtacacacaaaaccaaaacaatgtggttcttcttccatgcaacactatatcatttgatagaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12022298 |
cacagagggaaaatcaagttcattttctggatgcaacagtacacacaaaaccaaaacaatgtggttcttcttccatgcaacactatatcatttgatagaa |
12022199 |
T |
 |
| Q |
111 |
attaatatgaacttatatccaaccaacctgtagtgtggcggtgacattgtacctgggaagcttcctgtaatcaaatatcagagtgagttttttgtttgaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12022198 |
attaatatgaacttatatccaaccaacctgtagtgtggcggtgacattgtacctgggaagcttcctgtaatcaaatatcgaggtgagttttttgtttgaa |
12022099 |
T |
 |
| Q |
211 |
atttaatttattggagacacgtatatgaaatgaattggaaatacggcatcccg |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12022098 |
atttaatttattggagacacgtatatgaaatgaattggaaatacggcatcccg |
12022046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University