View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11252_high_16 (Length: 356)
Name: NF11252_high_16
Description: NF11252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11252_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 19 - 335
Target Start/End: Original strand, 36795417 - 36795742
Alignment:
| Q |
19 |
atattagacatgagcaatat--tattcgtccctttgtacttttagtcaaaagaaggttatggggaagggtctataagtgctgtcttcaagtcaaacggtt |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36795417 |
atattagacatgagcaatatattattcgtccatttgtacttttagtcaaaagaaggttatggggaagggtctataagtgctgtcttcaagtcaaacggtt |
36795516 |
T |
 |
| Q |
117 |
atgaccatgacatcacacatagatatggggctagagggatactatcttttaattaggattgtatcggtgagggaccactaatattaactttcacgtgtat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36795517 |
atgaccatgacatcacacatagatatggggctagagggatactatcttttaattaggattgtatcggtgagggaccactaatattaactttcacgtgtat |
36795616 |
T |
 |
| Q |
217 |
actatcaatagtatacacactacactagcaaccttagaaattcatcaatgtgaataaa------atgttcattatagtaacaacatcctcataaccct-t |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||||||||||||||| | |
|
|
| T |
36795617 |
actatcaatagtatacacactacactagcaaccttagaaattcatcaatgtgaataaaatgttcatgttcattctaataacaacatcctcataaccttaa |
36795716 |
T |
 |
| Q |
310 |
atagctaggaagccttattatggtac |
335 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
36795717 |
atagctaggaagccttattatggtac |
36795742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University