View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11252_low_27 (Length: 262)
Name: NF11252_low_27
Description: NF11252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11252_low_27 |
 |  |
|
| [»] scaffold0252 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0252 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: scaffold0252
Description:
Target: scaffold0252; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 20859 - 20638
Alignment:
| Q |
17 |
ctaatcacgaaattatccgaaagctgaattttaaccttctccagttcattctcaaccttatcatcccaatcagaccctgaaataatgccaaccacctttt |
116 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
20859 |
ctaatcacgaaattatccgaaag---aattttaaccttctccagttcattctcaaccttatcatcccaatcagacccttaagtaatgccaaccacctttt |
20763 |
T |
 |
| Q |
117 |
tgacaacattctgcattgcattctgcattgcattctgctcaagcatccctttgtagaaatgtgaaagcgcaacaacatcactcttcaacttctccccttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20762 |
tgacaacattctgcattgcattctgc------------tcaagcatccctttgtagaaatgtgaaagcgcaacaacatcactcttcaacttctccccttt |
20675 |
T |
 |
| Q |
217 |
taaacttgttgaaatcgtcacatgtgtctcttcatct |
253 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20674 |
taaactccttgaaatcgtcacatgtgtctcttcatct |
20638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 43435379 - 43435155
Alignment:
| Q |
17 |
ctaatcacgaaattatccgaaagctgaattttaaccttctccagttcattctcaaccttatcatcccaatcagaccctgaaataatgccaaccacctttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43435379 |
ctaatcacgaaattatccgaaagctgaattttaaccttctccagttcattctcaaccttatcatcccaatcagaccctgaaataatgccaaccacctttt |
43435280 |
T |
 |
| Q |
117 |
tgacaacattctgcattgcattctgcattgcattctgctcaagcatccctttgtagaaatgtgaaagcgcaacaacatcactcttcaacttctccccttt |
216 |
Q |
| |
|
| |||||||||||||||| |||| ||||||||||||||||| |||||||||||||| ||||||| |||||||||||| ||||||| ||| |
|
|
| T |
43435279 |
taacaacattctgcattg------------cattttgctcaagcatccctttatagaaatgtgaaagtgcaacaatatcactcttcaaattctccctttt |
43435192 |
T |
 |
| Q |
217 |
taaacttgttgaaatcgtcacatgtgtctcttcatct |
253 |
Q |
| |
|
|||| || |||||||||| || |||||||||||| |
|
|
| T |
43435191 |
caaacccgtagaaatcgtcaaatacgtctcttcatct |
43435155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 17 - 208
Target Start/End: Complemental strand, 43426874 - 43426695
Alignment:
| Q |
17 |
ctaatcacgaaattatccgaaagctgaattttaaccttctccagttcattctcaaccttatcatcccaatcagaccctgaaataatgccaaccacctttt |
116 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||| ||||||||||||| || || ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43426874 |
ctaatcacgaaattgtccgaaagttgaattttaaccttctcgagttcattctcaatctcattgtcccaatcagaccctgaaataataccaaccacctttt |
43426775 |
T |
 |
| Q |
117 |
tgacaacattctgcattgcattctgcattgcattctgctcaagcatccctttgtagaaatgtgaaagcgcaacaacatcactcttcaacttc |
208 |
Q |
| |
|
|||||||| |||||||| |||| |||||||||||||||||| |||||| ||||| | |||||||||||||||||| |||| |
|
|
| T |
43426774 |
tgacaacactctgcatt------------gcatcctgctcaagcatccctttatagaaacgtgaatactcaacaacatcactcttcatcttc |
43426695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University