View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11253_high_16 (Length: 215)
Name: NF11253_high_16
Description: NF11253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11253_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 47510643 - 47510823
Alignment:
| Q |
18 |
gttaggacggcttttagggtctctactaaggcaactataagctaactgagcaattttctgcaccgcttttaaagaataatttagttccaagcgaggatca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47510643 |
gttaggacggcttttagggtctctactaaggcaactataagctaactgagcaattttctgcaccgcttttaaagaataatttagttccaagcgaggatca |
47510742 |
T |
|
| Q |
118 |
acaagttggtacagttttcgcttgtcagctaaatatggtctagcccatgaaacaagattttgttccccgctcggacgcttc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47510743 |
acaagttggtacagttttcgcttgtcagctaaatatggtctagcccatgaaacaagattttgttccccgctcggacgcttc |
47510823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 50944336 - 50944156
Alignment:
| Q |
18 |
gttaggacggcttttagggtctctactaaggcaactataagctaactgagcaattttctgcaccgcttttaaagaataatttagttccaagcgaggatca |
117 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
50944336 |
gttaggacggcttttaggttctctactaaggcaactataagctaactgagcaattttctgcactgcttttaaagaataatttagttccaagcgaggatca |
50944237 |
T |
|
| Q |
118 |
acaagttggtacagttttcgcttgtcagctaaatatggtctagcccatgaaacaagattttgttccccgctcggacgcttc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
50944236 |
acaagttggtacagttttcgcttgtcagctaaatatggtctagcccatgaaacaagattttgctccccactcggacgcttc |
50944156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University