View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11253_high_17 (Length: 206)
Name: NF11253_high_17
Description: NF11253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11253_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 123 - 186
Target Start/End: Original strand, 39620538 - 39620601
Alignment:
| Q |
123 |
aacacgtgcatataaaactaaatctagatttatgttaaatctttttatgtcctcacttcggttt |
186 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39620538 |
aacacgtgcatataaaactaattctagatttatgttaaatctttttatgtcctcacttcggttt |
39620601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 17 - 69
Target Start/End: Original strand, 39620432 - 39620484
Alignment:
| Q |
17 |
cacagagtccgtgattttttggttggttggtaagtaagtgagtggccctagca |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39620432 |
cacagagtccgtgattttttggttggttggtaagtaagtgagtggccctagca |
39620484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University