View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11253_high_17 (Length: 206)

Name: NF11253_high_17
Description: NF11253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11253_high_17
NF11253_high_17
[»] chr1 (2 HSPs)
chr1 (123-186)||(39620538-39620601)
chr1 (17-69)||(39620432-39620484)


Alignment Details
Target: chr1 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 123 - 186
Target Start/End: Original strand, 39620538 - 39620601
Alignment:
123 aacacgtgcatataaaactaaatctagatttatgttaaatctttttatgtcctcacttcggttt 186  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
39620538 aacacgtgcatataaaactaattctagatttatgttaaatctttttatgtcctcacttcggttt 39620601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 17 - 69
Target Start/End: Original strand, 39620432 - 39620484
Alignment:
17 cacagagtccgtgattttttggttggttggtaagtaagtgagtggccctagca 69  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
39620432 cacagagtccgtgattttttggttggttggtaagtaagtgagtggccctagca 39620484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University