View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11253_low_16 (Length: 216)

Name: NF11253_low_16
Description: NF11253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11253_low_16
NF11253_low_16
[»] chr4 (1 HSPs)
chr4 (69-200)||(43554947-43555078)


Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 69 - 200
Target Start/End: Complemental strand, 43555078 - 43554947
Alignment:
69 tttgataaattactaaccatctnnnnnnntttatcagatgaattggaactaatttttaaatttttattgttagatgaattgaatagatttaacttttgat 168  Q
    ||||||||||||||||||||||       || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||    
43555078 tttgataaattactaaccatctaaaaaaattaatcagatgaattggaactaatttttaaattattattgttagatgaattgaatagatttaactttagat 43554979  T
169 gaattgcatatatgtgaagagatgaatatatt 200  Q
    ||||||||||||||||||||||||||||||||    
43554978 gaattgcatatatgtgaagagatgaatatatt 43554947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University