View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11253_low_16 (Length: 216)
Name: NF11253_low_16
Description: NF11253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11253_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 69 - 200
Target Start/End: Complemental strand, 43555078 - 43554947
Alignment:
| Q |
69 |
tttgataaattactaaccatctnnnnnnntttatcagatgaattggaactaatttttaaatttttattgttagatgaattgaatagatttaacttttgat |
168 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43555078 |
tttgataaattactaaccatctaaaaaaattaatcagatgaattggaactaatttttaaattattattgttagatgaattgaatagatttaactttagat |
43554979 |
T |
|
| Q |
169 |
gaattgcatatatgtgaagagatgaatatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43554978 |
gaattgcatatatgtgaagagatgaatatatt |
43554947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University