View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11254_low_2 (Length: 601)
Name: NF11254_low_2
Description: NF11254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11254_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-166; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-166
Query Start/End: Original strand, 272 - 583
Target Start/End: Original strand, 4612708 - 4613017
Alignment:
| Q |
272 |
tagcctcccataatttaacaacttcaagccattaggtaaatagccatgtgttgctgttgtggtgaagattgtaaattcaggcctcttggatttctcctag |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4612708 |
tagcctcccataatttaacaacttcaagcctttaggtaaatagccatgtgttgctgttgtggtgaagattgtaaattcaggcctcttggatttctcctag |
4612807 |
T |
|
| Q |
372 |
gcttgccttttgctttcttgtctctcataatttctcttgtaggtgcagttatttggattgttgggtaagtccctctcttttcccatctattagctatagc |
471 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4612808 |
gcttgccttttgctttcttgtctctcataatttctcttgtaggtgcagttatttggattgttgggtaagtccctctcttttcccatctattagc--tagc |
4612905 |
T |
|
| Q |
472 |
tgtagtattttctttgaaaataataattgagaacaagttatgaatgtgtttgatgctatataatggcaggttgactttgacatgcatatgtccatgctgt |
571 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4612906 |
tgtagtattttctttgaaaataataattgagaacaagttatgaatgtgtttgatgctatataatggcaggttgactttgacatgcatatgtccatgctgt |
4613005 |
T |
|
| Q |
572 |
ctttgcgtgacc |
583 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4613006 |
ctttgcgtgacc |
4613017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 117; E-Value: 3e-59
Query Start/End: Original strand, 12 - 128
Target Start/End: Original strand, 4612475 - 4612591
Alignment:
| Q |
12 |
agagaggaatgcttgtatcaacgtggactttaggtattggtaaccaaccaatgctgtttctttcttggaacaggttcaaaatctaggtggctactttcat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4612475 |
agagaggaatgcttgtatcaacgtggactttaggtattggtaaccaaccaatgctgtttctttcttggaacaggttcaaaatctaggtggctactttcat |
4612574 |
T |
|
| Q |
112 |
ttcactacgtgtacccg |
128 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
4612575 |
ttcactacgtgtacccg |
4612591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 201 - 231
Target Start/End: Original strand, 4612664 - 4612694
Alignment:
| Q |
201 |
cttgttctctccgtcaactatatagtactag |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4612664 |
cttgttctctccgtcaactatatagtactag |
4612694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University