View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11254_low_6 (Length: 266)
Name: NF11254_low_6
Description: NF11254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11254_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 869087 - 868832
Alignment:
| Q |
1 |
ctgcttggatgtgaaggtgtccgatcaatttcgatcaccctgccatttttggagcagtgcaagctggatttttatggtcttgggaactgttcactttcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
869087 |
ctgcttggatgtgaaggtgtccgatcaatttcgatcaccctgccatttttggagcagtgcaagctggatttttatggtcttgggaactgttcgctttcac |
868988 |
T |
|
| Q |
101 |
tgacctcccctaaaattgaatctcttgaggtacaaggctgtagttggattagggtccctgaaaccaagcatttgaagaacctttcaatttccaacagtgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
868987 |
tgacctcccctaaaattgaatctcttgaggtacaaggctgtagttggattagggtccctgaaaccaagcatttgaagaacctttcaatttccaacagtgc |
868888 |
T |
|
| Q |
201 |
aggtagtcgaatgtttcaagtgattcttgtactttcatatttcttgccgacctttg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
868887 |
aggtagtcgaatgtttcaagtgattcttgtactttcatatttcttactgacctttg |
868832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University