View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11256_low_7 (Length: 266)
Name: NF11256_low_7
Description: NF11256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11256_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 14 - 251
Target Start/End: Complemental strand, 10351505 - 10351265
Alignment:
| Q |
14 |
agaataatacctctccataatcgcaagctctataccgagaagattcccccctttttgcagcacctctgctttgaaaggttgctgttgcaccttgccgtgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10351505 |
agaataatacctctccataatcgcaagctctataacgaaaagattcccccctttttgcagcacctctgctttgaaaggttgctgttgcaccttgctgtgt |
10351406 |
T |
 |
| Q |
114 |
tatagtcgatggtgtaacccctactttgctgttcttgcaactgtcaatggtgtaactcgtactctggtgtt---gtgcctcacgacgcctcctcttagcg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10351405 |
tatagtcgatggtgtaacccctactttgctgttcttgctactgtcaatggtgtaactcttactctggtgttgtggtgcctcacgacgcctcctcttagcg |
10351306 |
T |
 |
| Q |
211 |
ctacactctgccaccatataggacatgtccatagtcataac |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10351305 |
ctacactctgccaccatataggacatgtccatagtcataac |
10351265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University