View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11258_low_16 (Length: 252)
Name: NF11258_low_16
Description: NF11258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11258_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 10981318 - 10981077
Alignment:
| Q |
1 |
ccgggacccaacatacctcttctctagccatacctgtccaataagaatgtttgtatcaaacaaattcaacatggcaccaaatgaatgaatttggtttagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10981318 |
ccgggacccaacatacctcttctctagccatacctgtccaataagaatgtttgtatcaaacaaattcaacatggcaccaaatgaatgaatttggtttagt |
10981219 |
T |
|
| Q |
101 |
ttggaacacactttaaacttgtaggtggaaggaccaaggtttgatcccccactgacattacacattttcggggagggacggtgtgctttaagtgtgacta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10981218 |
ttggaacacactttaaacttgtaggtggaaggaccaaggtttgataccccactgacattacacattttcggggagggacggtgtgctttaagtgtgacta |
10981119 |
T |
|
| Q |
201 |
aaattctatttggatagataacttaattaagtgcttatgatg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10981118 |
aaattctatttggatagataacttaattaagtgcttatgatg |
10981077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 238
Target Start/End: Complemental strand, 13630472 - 13630439
Alignment:
| Q |
205 |
tctatttggatagataacttaattaagtgcttat |
238 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
13630472 |
tctatttagatagataacttaattaagtgcttat |
13630439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University