View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11258_low_3 (Length: 489)
Name: NF11258_low_3
Description: NF11258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11258_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 444; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 444; E-Value: 0
Query Start/End: Original strand, 1 - 473
Target Start/End: Original strand, 36441863 - 36442335
Alignment:
| Q |
1 |
tgtcatggattctggtctctgcttagtgtctagtccaaaccatcaaaacatagttcaaaataatttctacgacccttcttggttacaaaaacaacgtaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36441863 |
tgtcatggattctggtctctgcttagtgtctagtccaaaccatcaaaacatagttcaaaataatttctacgacccttcttggttacaaaaacaacgtaac |
36441962 |
T |
 |
| Q |
101 |
gttccaatgaacttcgtttggccaaaagagtatctagtgaatgcaaatgaagagtttcaagcaccattgatagaccttgatgggttccttaaaggtaatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36441963 |
gttccaatgaacttcgtttggccaaaagagtatctagtgaatgcaaatgaagagtttcaagcaccattgatagaccttgatgggttccttaaaggtaatg |
36442062 |
T |
 |
| Q |
201 |
aagaaaccacaaacaatgttgcaaagctcatatccaaagcttgttcaagtcatggattttttcaagtgattaaccatggtgttgatttgagtctcattgg |
300 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36442063 |
aagaaaccacaaacaatgttgcaatgctcatatccaaagcttgttcaactcatggattttttcaagtgattaaccatggtgttgatttgagtctcattgg |
36442162 |
T |
 |
| Q |
301 |
tgaagcttatgatcaaatggatgcnnnnnnnaagcaaccaattgataagaaacttattgctcgtaagataaaaggttcaatgtggggttattctggtgca |
400 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36442163 |
tgaagcttatgatcaaatggatgctttttttaagcaaccaattgataagaaacttattgctcgtaagataaaaggttcaatgtggggttattctggtgca |
36442262 |
T |
 |
| Q |
401 |
catgctgataggttctcctccaaattgccttggaaggaaacactttctttcccttttcatgataataatgtct |
473 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36442263 |
catgctgataggttctcctccaaattgccttggaaggaaacactttctttcccttttcatgataataatgtct |
36442335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University