View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11259_high_5 (Length: 275)
Name: NF11259_high_5
Description: NF11259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11259_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 20 - 261
Target Start/End: Original strand, 27694633 - 27694874
Alignment:
| Q |
20 |
gcacaaggtcaataagtcatattggtttgttagatggacatggtgattgatcagcattcgaaatggctatttggttaaaaactctcatccatgtgttctt |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27694633 |
gcactaggtcaataagtcatattggtttgttagatggacatggtgattgatcagcattcgaaatggctatttggttaaaaactctcatccatgtgttctt |
27694732 |
T |
 |
| Q |
120 |
gttctgctttttaattacagttgaaattgcagaaactagttttcatgatgaccaatgcaaagaatcaagttgtgatggtattcatggaccattcataaga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27694733 |
gttctgctttttaattacagttgaaattgcggaaactagttttcatgatgacccatgcaaagaatcaagttgtgatggtattcatggaccattcataaga |
27694832 |
T |
 |
| Q |
220 |
ttcccgttcagactcataggaagacagccacaatggtgtggc |
261 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27694833 |
ttcccgttcagactcaaaggaagacagccacaatggtgtggc |
27694874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University