View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11259_low_4 (Length: 380)
Name: NF11259_low_4
Description: NF11259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11259_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 1e-54; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 14 - 158
Target Start/End: Original strand, 5752211 - 5752355
Alignment:
| Q |
14 |
gaagcagttgattgatgatgttaggaaggctctttacgcagccaagatctgtggttacgcataagggatgaatctgatcagtgcaaagagcactgaaaag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||| ||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
5752211 |
gaagcagttgattgatgatgttaggaaggctctttatgcagccaagatttgtagttacgcacaagggatgaatctgatccgtgcaaagagtgctgaaaag |
5752310 |
T |
|
| Q |
114 |
ggatgggatttggcattgggtgaacttgcccgtatttggaaagga |
158 |
Q |
| |
|
|| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5752311 |
ggttgggatttggaattgggtgaacttgcccgtatttggaaagga |
5752355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 234 - 365
Target Start/End: Original strand, 5752456 - 5752587
Alignment:
| Q |
234 |
aaataattgaatgccaaaccgcatggaggagagttgtttcccttgctgtcaattcaggtatcagcatcccaggtatgtatgctagtcttgcatattttga |
333 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
5752456 |
aaataattgaacgccaaaccgcatggaggagagttgtttcccttgctgtcaattcaggtatcagcctcccgggtatgtctgctagtcttgcatattttga |
5752555 |
T |
|
| Q |
334 |
cacttatagaagggaaaggttgccacctaatt |
365 |
Q |
| |
|
| ||||||||||||||||||||||| |||||| |
|
|
| T |
5752556 |
ctcttatagaagggaaaggttgccagctaatt |
5752587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 218
Target Start/End: Original strand, 5752399 - 5752452
Alignment:
| Q |
166 |
cgtacgacagaa-ccctaatcttacaaaccttcttgtggatccaaagttcgcaa |
218 |
Q |
| |
|
|||||||||||| ||||||||| | |||||||||||||||||| ||||||||| |
|
|
| T |
5752399 |
cgtacgacagaaaccctaatctcgctaaccttcttgtggatccagagttcgcaa |
5752452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University