View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11259_low_4 (Length: 380)

Name: NF11259_low_4
Description: NF11259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11259_low_4
NF11259_low_4
[»] chr7 (3 HSPs)
chr7 (14-158)||(5752211-5752355)
chr7 (234-365)||(5752456-5752587)
chr7 (166-218)||(5752399-5752452)


Alignment Details
Target: chr7 (Bit Score: 109; Significance: 1e-54; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 14 - 158
Target Start/End: Original strand, 5752211 - 5752355
Alignment:
14 gaagcagttgattgatgatgttaggaaggctctttacgcagccaagatctgtggttacgcataagggatgaatctgatcagtgcaaagagcactgaaaag 113  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||| ||||||||||||||||| ||||||||||  ||||||||    
5752211 gaagcagttgattgatgatgttaggaaggctctttatgcagccaagatttgtagttacgcacaagggatgaatctgatccgtgcaaagagtgctgaaaag 5752310  T
114 ggatgggatttggcattgggtgaacttgcccgtatttggaaagga 158  Q
    || |||||||||| |||||||||||||||||||||||||||||||    
5752311 ggttgggatttggaattgggtgaacttgcccgtatttggaaagga 5752355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 234 - 365
Target Start/End: Original strand, 5752456 - 5752587
Alignment:
234 aaataattgaatgccaaaccgcatggaggagagttgtttcccttgctgtcaattcaggtatcagcatcccaggtatgtatgctagtcttgcatattttga 333  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |||||||||||||||||||||    
5752456 aaataattgaacgccaaaccgcatggaggagagttgtttcccttgctgtcaattcaggtatcagcctcccgggtatgtctgctagtcttgcatattttga 5752555  T
334 cacttatagaagggaaaggttgccacctaatt 365  Q
    | ||||||||||||||||||||||| ||||||    
5752556 ctcttatagaagggaaaggttgccagctaatt 5752587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 218
Target Start/End: Original strand, 5752399 - 5752452
Alignment:
166 cgtacgacagaa-ccctaatcttacaaaccttcttgtggatccaaagttcgcaa 218  Q
    |||||||||||| |||||||||  | |||||||||||||||||| |||||||||    
5752399 cgtacgacagaaaccctaatctcgctaaccttcttgtggatccagagttcgcaa 5752452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University