View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11259_low_7 (Length: 260)
Name: NF11259_low_7
Description: NF11259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11259_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 27694477 - 27694223
Alignment:
| Q |
1 |
ccaaactctaaaaatcttttgtccccaaaccgtgggcccaggcgggtttaaaaggataaaaaatgagtgatgaggcattattgg-------------ttg |
87 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
27694477 |
ccaaactctaaaaatcttttgtccctaaaccgtgggcccaggcgggtttaaaaggataaaaaatgagtgatgaggcattattgggcggttcatgtggttg |
27694378 |
T |
|
| Q |
88 |
acttgaagtcagcaccaagtgagataattagtccaggtagctagccatgactgactgactgagtcgagcagatcccccaaccaaccccaaaaaatcaaaa |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27694377 |
acttgaagtcagcaccaagtgagataattagtccaggtagc----catgactgactgactgagtcgagcagatcccccaaccaaccccaaaaaatcaaaa |
27694282 |
T |
|
| Q |
188 |
tggctatgatgtacggggtactacccattttcgctgccattttaatattgatctctgtg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27694281 |
tggctatgatgtacggggtactacccattttcgctgccattttaatattgatctctgtg |
27694223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University