View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1125_high_48 (Length: 335)
Name: NF1125_high_48
Description: NF1125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1125_high_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 330
Target Start/End: Original strand, 28864378 - 28864707
Alignment:
| Q |
1 |
actggaagacagaagattgcagaatgcgcagttaaaattgctgagaccagattgctgaaggacaattggcctgaatattatgatggaaagctaggtagat |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28864378 |
actggaagacagaagattgcagaacacgcacttaaaattgctgagaccagattgctgaaggacaattggccctaatattatgatggaaagctaggtagat |
28864477 |
T |
|
| Q |
101 |
acattgggaagcaagctaggaaatgccaaacttggtctgttgctggttacttagttgctaagctgatgatggaggatccattacatttgcgtatggtggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28864478 |
gtattgggaagcaagctaggaaatgccaaacttggtctgttgctggttacttagttgctaagctgatgatggaggatccattacatttgcgtatggtggc |
28864577 |
T |
|
| Q |
201 |
cttcgaggaagataaactcctaagtcctcaacacagaagatcaaaatcatgcccatggtgatgaggtaaatgcaatggaaaaagttcaagatgaaacact |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
28864578 |
cttcgaggaagataaactcctaagtcctcaacacagaagatcaaaatcatgcccatggtgatgaggtaaatgcaatggaaaaagtgcaaggtgaaacact |
28864677 |
T |
|
| Q |
301 |
gtaaatgaaacactgcaaagaattatctac |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28864678 |
gtaaatgaaacactgcaaagaattatctac |
28864707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 35 - 149
Target Start/End: Complemental strand, 55111013 - 55110899
Alignment:
| Q |
35 |
aaattgctgagaccagattgctgaaggacaattggcctgaatattatgatggaaagctaggtagatacattgggaagcaagctaggaaatgccaaacttg |
134 |
Q |
| |
|
||||||| ||| ||||| |||| || ||||| ||||| || ||||||||||||| | ||| |||||||||| ||||| ||| | ||||||||||| || |
|
|
| T |
55111013 |
aaattgccgaggccagactgctaaaagacaactggccggagtattatgatggaacacatggtcgatacattggaaagcaggctcgaaaatgccaaacctg |
55110914 |
T |
|
| Q |
135 |
gtctgttgctggtta |
149 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
55110913 |
gtctattgctggtta |
55110899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 67 - 176
Target Start/End: Complemental strand, 43229488 - 43229379
Alignment:
| Q |
67 |
tggcctgaatattatgatggaaagctaggtagatacattgggaagcaagctaggaaatgccaaacttggtctgttgctggttacttagttgctaagctga |
166 |
Q |
| |
|
|||||||||||||||||||| || || || ||||| ||||||| || || || |||| |||||| |||||| |||| ||||| || || || ||| ||| |
|
|
| T |
43229488 |
tggcctgaatattatgatggtaaacttggaagatatgttgggaaacaggcaagaaaataccaaacatggtctattgcgggttatttggtggcaaagatga |
43229389 |
T |
|
| Q |
167 |
tgatggagga |
176 |
Q |
| |
|
|| ||||||| |
|
|
| T |
43229388 |
tgctggagga |
43229379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 67 - 179
Target Start/End: Complemental strand, 43220414 - 43220302
Alignment:
| Q |
67 |
tggcctgaatattatgatggaaagctaggtagatacattgggaagcaagctaggaaatgccaaacttggtctgttgctggttacttagttgctaagctga |
166 |
Q |
| |
|
|||||||||||||||||||| ||||| || ||||| |||| | |||| || |||| |||||| |||||| |||| ||||| | ||| ||||| ||| |
|
|
| T |
43220414 |
tggcctgaatattatgatggtaagcttggaagatatgttggtagaaaagcaagaaaataccaaacatggtctattgcaggttatctggtttctaagatga |
43220315 |
T |
|
| Q |
167 |
tgatggaggatcc |
179 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
43220314 |
tgctggaggatcc |
43220302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University