View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1125_high_64 (Length: 293)
Name: NF1125_high_64
Description: NF1125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1125_high_64 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 16814422 - 16814695
Alignment:
| Q |
1 |
ggcggttgtccaaggttgtcttataaacccgatgttgctccccatcctcaacatcagggtcggttctttctctgaaggcatagtccagaatctgcctctt |
100 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
16814422 |
ggcggtcgtccacagttgtcttataaacccgttgttgctctccatcctcaacatcagggtcggttctttctctgaaggcatagtccagaatctgcctttt |
16814521 |
T |
 |
| Q |
101 |
cttggtggaggatgctggtttctgtggattaaaacattggttgttataggccgtaaaatgttattctattcgccgatgtatgtgttcgaataccctttta |
200 |
Q |
| |
|
|||||||| |||||||||||||||| ||| ||||||||||||||||||||| |||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16814522 |
cttggtggtggatgctggtttctgttgatcaaaacattggttgttataggctgtaaaatgttgttctattccccgatgtatgtgttcgaataccctttta |
16814621 |
T |
 |
| Q |
201 |
caggtttgatttctcaaaatatgcgtttcacgcatggttatgctcccccaagatcatcgttagtgtggttgtta |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||||| |
|
|
| T |
16814622 |
caggtttgatttctcaaaatatgcgtttcacgcatggttctgttcccccaagatcattgttagtgtggttgtta |
16814695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University