View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1125_high_73 (Length: 251)
Name: NF1125_high_73
Description: NF1125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1125_high_73 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 12 - 251
Target Start/End: Complemental strand, 5313677 - 5313438
Alignment:
| Q |
12 |
gaatatgaacaaatttcaattcaaaggattcaacaactgcaaaatttaaagcatacacctgaccgatatactgtcattgttcgtgaaattccattatgta |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5313677 |
gaatatgaagaaatttcaattcaaaggattcaacaactgcaaaatttaaagcatacacctgaccgatatactgtcattgttcgtgaaattccattatgta |
5313578 |
T |
|
| Q |
112 |
ttgaacacaaggctcgtgactgttctgttcatcattttttctctaaatactatccaaacacttactattcctatcaaatggtgtataacactgaaaatct |
211 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5313577 |
ttgaacacaaggctcgcgactgttctgttcatcattttttctctaaatactatccaaacacttactattcctatcaaatggtgtataacactgaaaatct |
5313478 |
T |
|
| Q |
212 |
tgatgagttaatggtacgaagctataatgtgcattattac |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5313477 |
tgatgagttaatggtacgaagctataatgtgcattattac |
5313438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University