View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1125_high_81 (Length: 210)
Name: NF1125_high_81
Description: NF1125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1125_high_81 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 3 - 122
Target Start/End: Complemental strand, 17470826 - 17470707
Alignment:
| Q |
3 |
gagcaagctgagataagggagcctttgcatggggaggcatctctttctcttgctaaggcaggtgatgatttgcgtatgaaattgttgtacctagaaaacc |
102 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17470826 |
gagcaagctgagagaagggagcctttacatggggaggcatctctttctcttgctaaggcaggggatgatttgcgtatgaaattgttgtacctggaaaacc |
17470727 |
T |
|
| Q |
103 |
gaggtattttcttacatgtt |
122 |
Q |
| |
|
|||||| |||| |||||||| |
|
|
| T |
17470726 |
gaggtactttcctacatgtt |
17470707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University