View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1125_low_103 (Length: 211)
Name: NF1125_low_103
Description: NF1125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1125_low_103 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 53 - 194
Target Start/End: Complemental strand, 5441519 - 5441378
Alignment:
| Q |
53 |
catacaataactatgaacatatctataaagttgatagaatgggtaacctcccatacctgatccaaatgaacatcactatgtagttacaacttgagaagat |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5441519 |
catacaataactatgaacatatctataaagttgatagaatgggtaacctcccatacctgatccaaatgaacatcaatatgtagttacaacttgagaagat |
5441420 |
T |
 |
| Q |
153 |
tgatagcattcaatttgtgagtcattatctatttgcctatgc |
194 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5441419 |
agatagcattcaatttatgagtcattatctatttgcctatgc |
5441378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University