View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1125_low_12 (Length: 563)
Name: NF1125_low_12
Description: NF1125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1125_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 5e-82; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 5e-82
Query Start/End: Original strand, 362 - 556
Target Start/End: Complemental strand, 30565505 - 30565311
Alignment:
| Q |
362 |
ttcgattatttcattaattgaatgcttgtgtaaaacttttttaccaacaaaatgtttctagttgattatggttataagaatggtgnnnnnnnnataaata |
461 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
30565505 |
ttcgattatttcattaattgaatgcttgtgtaaaacttttttactaacaaaatgtttctagttgattatgattataagaatggtgttttttttataaata |
30565406 |
T |
|
| Q |
462 |
ttttagtgaaatcatagtattagtaactaataatgaataaaagacaaataggactaagcaagttagcgtatcaaactatgaggtgatctgtggtg |
556 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30565405 |
ttttagtgaaatcatagtattagtaactaataatgattaaaagacaaataggactaagcaagttagcgtatcaaactatgaggtgatgtgtggtg |
30565311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 235 - 291
Target Start/End: Complemental strand, 30565630 - 30565574
Alignment:
| Q |
235 |
ctactagtatgtaagccaagtgtgtttaaatttctattcttttttacttgagtttaa |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30565630 |
ctactagtatgtaagccaagtgtgtttaaatttctattcttttttacttgagtttaa |
30565574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 132
Target Start/End: Complemental strand, 30565768 - 30565733
Alignment:
| Q |
97 |
ctatgctcttttgttgctgaaattttgattccaacg |
132 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30565768 |
ctatgctcttttgttgctgaaattttgactccaacg |
30565733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University