View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1125_low_51 (Length: 359)
Name: NF1125_low_51
Description: NF1125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1125_low_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 3e-85; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 139 - 302
Target Start/End: Complemental strand, 8885993 - 8885830
Alignment:
| Q |
139 |
cacacataccataagagtttgagggttgaagtaagtgtgtccaaggtgaagctgattaggagcaggaaggagcaaagcacgcatgttaactgagagaagg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8885993 |
cacacataccataagagtttgagggttgaagtaagtgtgtccaaggtgaagctgattaggagcaggaaggagcaaagcacgcatgttaactgagagaagg |
8885894 |
T |
|
| Q |
239 |
ttggtgcaatgatcacatctcactgtcacagtcttgaacaaacttgtgcaaggaacactcacct |
302 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8885893 |
ttggtgcaatgaccacatctcactgtcacagtcttgaacaaacttgtgcaaggaacactcacct |
8885830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 215 - 302
Target Start/End: Original strand, 42026227 - 42026314
Alignment:
| Q |
215 |
gcacgcatgttaactgagagaaggttggtgcaatgatcacatctcactgtcacagtcttgaacaaacttgtgcaaggaacactcacct |
302 |
Q |
| |
|
||||||||||| |||| || || || ||||||||| | |||||||| ||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
42026227 |
gcacgcatgttgactggaagcagattagtgcaatgaccgcatctcacagtcacggtcttgaacaagcttgtgcaaggaacactcacct |
42026314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 93 - 123
Target Start/End: Complemental strand, 8886023 - 8885993
Alignment:
| Q |
93 |
atatttgcttgtataaaaatcacacaaacac |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8886023 |
atatttgcttgtataaaaatcacacaaacac |
8885993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 330 - 359
Target Start/End: Complemental strand, 8885804 - 8885775
Alignment:
| Q |
330 |
tctataattagtatcttaattcttaattaa |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
8885804 |
tctataattagtatcttaattcttaattaa |
8885775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University