View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1125_low_54 (Length: 348)
Name: NF1125_low_54
Description: NF1125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1125_low_54 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 9e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 135 - 251
Target Start/End: Complemental strand, 40962255 - 40962139
Alignment:
| Q |
135 |
aaaaacaataaaccttccggtatctccagatcccaaaggtttaattggcctaaagtgctttaggcttatctgttctccattttcgatgatctgcaaaacc |
234 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40962255 |
aaaaaaaataaaccttccggtatctccagatcccaaaggtttaattggcctaaagtgctttaggcttatctgttctccattttcgatgatctgcaaaacc |
40962156 |
T |
|
| Q |
235 |
atagtgttgtctgtaac |
251 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
40962155 |
atagtgttgtgtgtaac |
40962139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 79 - 118
Target Start/End: Complemental strand, 40962294 - 40962255
Alignment:
| Q |
79 |
tatcataggcatgtatgtagtttgtacttggaaaagagaa |
118 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
40962294 |
tatcatggacatgtatgtagtttgtacttggaaaagagaa |
40962255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 169 - 236
Target Start/End: Complemental strand, 22797940 - 22797873
Alignment:
| Q |
169 |
aaaggtttaattggcctaaagtgctttaggcttatctgttctccattttcgatgatctgcaaaaccat |
236 |
Q |
| |
|
||||||||||||||| |||| ||||| | || ||||||||||||| | || ||||||||||||||||| |
|
|
| T |
22797940 |
aaaggtttaattggcttaaaatgcttcaagcctatctgttctccactctccatgatctgcaaaaccat |
22797873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University