View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1125_low_76 (Length: 294)
Name: NF1125_low_76
Description: NF1125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1125_low_76 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 16814446 - 16814226
Alignment:
| Q |
1 |
tataagacaaccttggacaaccgccgccatagacgatgttgtaacaacggtttgccatttcggaacgggaaacaaatggtcatcagaaaagagatcaaac |
100 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| || ||||| ||||||||||||||||||| | |
|
|
| T |
16814446 |
tataagacaactgtggacgaccgccgccatagacgatgttgtaacaacggtttgccatttcagaacggggaaaaaatgctcatcagaaaagagatcaa-c |
16814348 |
T |
|
| Q |
101 |
cgttgttaaagaacaacaatcaaacaagatgtctctgctgacgacggcgcagagttgcaagaacctgacccatactagtttgaccaaccaaacaaaagac |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16814347 |
cgttgttcaagaacaacaatcaaacaagatgtatctgctgacgacggtgcacagttgtaagaacctgacccatactagtttgaccaaccaaacaaaagac |
16814248 |
T |
|
| Q |
201 |
caaagtacatgttctgacaaag |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
16814247 |
caaagtacatgttctgacaaag |
16814226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University