View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1125_low_81 (Length: 277)
Name: NF1125_low_81
Description: NF1125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1125_low_81 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 47; Significance: 7e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 125 - 175
Target Start/End: Original strand, 31413058 - 31413108
Alignment:
| Q |
125 |
ttttgttttgagaaagatttgatcatgtggagcaagatatcatattggttt |
175 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31413058 |
ttttgttttgagaaagatatgatcatgtggagcaagatatcatattggttt |
31413108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 66
Target Start/End: Original strand, 31412953 - 31412991
Alignment:
| Q |
28 |
gggtttggagatggagaagaggatgaaggagttatgttt |
66 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31412953 |
gggtttggagatggagaaagggatgaaggagttatgttt |
31412991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 139 - 175
Target Start/End: Complemental strand, 2769822 - 2769786
Alignment:
| Q |
139 |
agatttgatcatgtggagcaagatatcatattggttt |
175 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
2769822 |
agatatgatcatgtggagcaagatatcttattggttt |
2769786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University