View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1125_low_98 (Length: 233)

Name: NF1125_low_98
Description: NF1125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1125_low_98
NF1125_low_98
[»] chr6 (6 HSPs)
chr6 (141-233)||(176285-176377)
chr6 (141-231)||(1470933-1471023)
chr6 (141-233)||(1459549-1459641)
chr6 (141-233)||(7564759-7564851)
chr6 (140-233)||(370793-370886)
chr6 (151-233)||(1442116-1442198)
[»] chr4 (1 HSPs)
chr4 (150-233)||(55419742-55419825)
[»] chr7 (1 HSPs)
chr7 (141-233)||(3927010-3927102)


Alignment Details
Target: chr6 (Bit Score: 89; Significance: 5e-43; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 141 - 233
Target Start/End: Original strand, 176285 - 176377
Alignment:
Q  141 ggtttctagggattgcctatgcgtccttgctcacaccgaaacttttttggatatttggcgtatgaacgattatggaaataaagattcttggac 233  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  176285 ggtttctagggattgcctatgcgtccttgctcacaccgaaacttttttggatatttggcgtatgaatgattatggaaataaagattcttggac 176377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 141 - 231
Target Start/End: Complemental strand, 1471023 - 1470933
Alignment:
Q  141 ggtttctagggattgcctatgcgtccttgctcacaccgaaacttttttggatatttggcgtatgaacgattatggaaataaagattcttgg 231  Q
    |||||||||||||| | ||||| |||||||||| ||| || |||||||||||||||||  |||||| ||||||||||||||||||||||||    
T  1471023 ggtttctagggattacttatgcatccttgctcataccaaatcttttttggatatttgggttatgaaagattatggaaataaagattcttgg 1470933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 141 - 233
Target Start/End: Complemental strand, 1459641 - 1459549
Alignment:
Q  141 ggtttctagggattgcctatgcgtccttgctcacaccgaaacttttttggatatttggcgtatgaacgattatggaaataaagattcttggac 233  Q
    ||||| |||||||| | |||||||||||||||| ||  || |||||||||||||||||  |||||| |||| |||||||||||| ||||||||    
T  1459641 ggtttatagggattacttatgcgtccttgctcatacaaaatcttttttggatatttgggttatgaaagattttggaaataaagaatcttggac 1459549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 141 - 233
Target Start/End: Complemental strand, 7564851 - 7564759
Alignment:
Q  141 ggtttctagggattgcctatgcgtccttgctcacaccgaaacttttttggatatttggcgtatgaacgattatggaaataaagattcttggac 233  Q
    ||||| |||||||||| |||| ||||||||||||||   |||||||||| ||||||||  |||||| ||||||||||| || |||||||||||    
T  7564851 ggtttgtagggattgcttatgggtccttgctcacactacaacttttttgaatatttgggttatgaaggattatggaaacaaggattcttggac 7564759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 140 - 233
Target Start/End: Complemental strand, 370886 - 370793
Alignment:
Q  140 aggtttctagggattgcctatgcgtccttgctcacaccgaaacttttttggatatttggcgtatgaacgattatggaaataaagattcttggac 233  Q
    ||||||||||||||||| ||||| |||||||||| ||  |||||||| |||   |||||  ||||||  |||||||||||||||||||||||||    
T  370886 aggtttctagggattgcttatgcatccttgctcagactaaaacttttatgggcgtttgggttatgaagaattatggaaataaagattcttggac 370793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 151 - 233
Target Start/End: Complemental strand, 1442198 - 1442116
Alignment:
Q  151 gattgcctatgcgtccttgctcacaccgaaacttttttggatatttggcgtatgaacgattatggaaataaagattcttggac 233  Q
    |||||| ||||| |||||||||| | || |||| |||||||||  |||  |||||| |||||||||| |||||||||||||||    
T  1442198 gattgcttatgcatccttgctcaaaacggaactattttggatacatgggttatgaaggattatggaattaaagattcttggac 1442116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 150 - 233
Target Start/End: Original strand, 55419742 - 55419825
Alignment:
Q  150 ggattgcctatgcgtccttgctcacaccgaaacttttttggatatttggcgtatgaacgattatggaaataaagattcttggac 233  Q
    ||||||| |||||||| ||||||||||| |  ||||||||||||| |||| |||||| | ||||||||||||||||||||||||    
T  55419742 ggattgcttatgcgtcgttgctcacaccaattcttttttggatatctggcttatgaaggtttatggaaataaagattcttggac 55419825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 141 - 233
Target Start/End: Original strand, 3927010 - 3927102
Alignment:
Q  141 ggtttctagggattgcctatgcgtccttgctcacaccgaaacttttttggatatttggcgtatgaacgattatggaaataaagattcttggac 233  Q
    |||||||| ||||||| | || ||||||| | |||| |||||||| |||| |||||||  |||||| ||||||||||||||| ||||||||||    
T  3927010 ggtttctaaggattgcttgtgtgtccttgtttacactgaaactttgttgggtatttgggttatgaaggattatggaaataaaaattcttggac 3927102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University