View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11260_high_23 (Length: 257)
Name: NF11260_high_23
Description: NF11260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11260_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 51 - 235
Target Start/End: Complemental strand, 41104853 - 41104669
Alignment:
| Q |
51 |
ctgctgctgtggcgccaatggtggtttcttgattttgtgagagtccttgtgtattctaagaggtgtaggacgtggaccttgaagttctcttcttggtgat |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41104853 |
ctgctgctgtggcgccaatggtggtttcttgattttgtgagagtccttgtgtattctaagaggtgtaggacgtggaccttgaagttctcttcttggtgat |
41104754 |
T |
 |
| Q |
151 |
cttcccgtaggaatgtctgggaattgattcattttgttctataataaaaattgtattgtgattagatgaggaaaaggggtgtgag |
235 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41104753 |
cttcctgtaggaatgtctgggaattgattcattttgttctataataaaaattgtattgtgattagatgaggaaaaggggtgtgag |
41104669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University