View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11260_high_28 (Length: 240)
Name: NF11260_high_28
Description: NF11260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11260_high_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 23 - 225
Target Start/End: Complemental strand, 31532856 - 31532650
Alignment:
| Q |
23 |
tgatcatcacttgtg--agatatgagtgttatcattatttttaactcttgagtaagagtattgtaggttgatacacaatccgagattgagttacaatcat |
120 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31532856 |
tgatcatcacttgtgtgagatatgagtgttatcattatttttaactcttgagtaagagtattgtaggttgatacacaatccgagattgagttacaatcat |
31532757 |
T |
|
| Q |
121 |
tgtaatactttttgagatagtaaatacattatattgagatgtt-tatgtggatgta-cataacaagtgtcgaaccacgtagatctttgttcgtttgttct |
218 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| |||||||||||| | ||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
31532756 |
tgcaatactttttgagatagtaaatacattatattgagatgttatatgtggatgtaccgtaacaagtgtcgaaccacgtaaatctttgttcatttgttct |
31532657 |
T |
|
| Q |
219 |
ctctgtg |
225 |
Q |
| |
|
|| |||| |
|
|
| T |
31532656 |
ctttgtg |
31532650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University