View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11260_high_31 (Length: 222)
Name: NF11260_high_31
Description: NF11260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11260_high_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 14 - 205
Target Start/End: Complemental strand, 1974104 - 1973913
Alignment:
| Q |
14 |
agatgaaggatgtggtattgaggaagcaaaagctatttgtgagccagaaatcattcgtcagctttttacttggcaggttgaaacatgttatcctacataa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1974104 |
agatgaaggatgtggtattgaggaagcaaaagctatttgtgagccagaaatcattcgtcagctttttacttggcaggttgaaacatgttatcctacataa |
1974005 |
T |
 |
| Q |
114 |
tcttttgtagtactttttagattcatagaggtgtaatttacaaacaatcgtatgtctctctctaactgctcaagctatttccgtgaacaatt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1974004 |
tcttttgtagtactttttagattcatagaggtgtaatttacaaacaatcgtatgtctctctctaactgctcaagctatttccgtgaacaatt |
1973913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University