View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11260_high_6 (Length: 442)
Name: NF11260_high_6
Description: NF11260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11260_high_6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 367; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 20 - 442
Target Start/End: Original strand, 2223111 - 2223532
Alignment:
| Q |
20 |
gtgcggttatgatttctttgcggtttatgacggtcatggtggtatgacggtggcgaatgcttgccgtgataggctgcacttgttgttggcggaggaagtg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2223111 |
gtgcggttatgatttctttgcggtttatgacggtcatggtggtatgacggtggcgaatgcttgccgtgataggttgcacttgttgttggcggaggaagtg |
2223210 |
T |
|
| Q |
120 |
aaggagggtaggaggaatcatggattggattggtgtgaagctatgtgttcttgttttatgaaaatggatagtgaaattggagtcggtggaagttgtggtg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2223211 |
aaggagggtaggaggaatcatggattggattggtgtgaagctatgtgttcttgttttatgaagatggatagtgaaattggagtcggtggaagttgtggtg |
2223310 |
T |
|
| Q |
220 |
atgaggttgatgggaataccgtgggttcgacggcggctgtggtggtggtggggaaggaggagattgtagtggcgaattgtggtgactcaagggcggtgct |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2223311 |
atgaggttgatgggaataccgtgggttcgacggcggctgtggtggtggtggggaaggaggagattgtagtggcgaattgtggtgactcaagggcggtgct |
2223410 |
T |
|
| Q |
320 |
ttgtagtggcggtgtagcggggccactttcacgagatcataaggggatggttaattaatggtgactcctgagatatnnnnnnnnttacaattaagcaaaa |
419 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |||||||||||| || |
|
|
| T |
2223411 |
ttgtagtggcggtgtagcggtgccactttcacgagatcataaggtgatggttaattaatggtgactcatgagatataaagaaacttacaattaagc-aac |
2223509 |
T |
|
| Q |
420 |
taaacatgtacacttaattctca |
442 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2223510 |
taaacatgtacacttaattctca |
2223532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University