View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11260_high_9 (Length: 400)
Name: NF11260_high_9
Description: NF11260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11260_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 11 - 371
Target Start/End: Complemental strand, 2937960 - 2937600
Alignment:
| Q |
11 |
cagagattgttattgccaagtggaacaactatggatatctgtttgtgttagttttctcaacactcactaccaaatgagtgtcaaccaggccagagtcatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2937960 |
cagagattgttattgccaagtggaacaactatggatatctgtttgtgttagttttctcaacactcactaccaaatgagtgtcaaccaggccagagtcatt |
2937861 |
T |
|
| Q |
111 |
tggttgcaaaaattctttatgtttcttgtatggcgtaaacacaaaatcgcttgcatacattgagggattctttcatgttgttatatgatgcatgcatatt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2937860 |
tggttgcaaaaattctttatgtttcttgtatggcgtaaacacaaaatcgcttgcatacattgagggattctttcatattgttatatgatgcatgcatatt |
2937761 |
T |
|
| Q |
211 |
tacgtactactccttaattacaaacacaatagataacatggaatttcaaaactcaagtacctagagcatcaaactgcaccaattgctagaaaaaggaata |
310 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2937760 |
tacgtactactccttaattacagacacaatagataacatggaatttcaaaactgaagtacctagagcatcaaactgcaccaattgctagaaaaaggaata |
2937661 |
T |
|
| Q |
311 |
atagaaatgtatgcttatatatacatttaagatgttgttcatctgattctatgtaaacaca |
371 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2937660 |
atagaaatgtttgcttatatatacatttaagatgttgttcatctgattctatgtaaacaca |
2937600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University