View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11260_low_17 (Length: 314)
Name: NF11260_low_17
Description: NF11260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11260_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 295
Target Start/End: Original strand, 25963690 - 25963984
Alignment:
| Q |
1 |
acagggttagatttgggtgaaaataaaatagagtttttaactgttacaaataatgtgtttttggaacagccaaagaaatctcattatgttactatcttca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25963690 |
acagggttagatttgggtgaaaataaaatagagtttttaactgttacaaataatgtgtttttggaacagccaaagaaatctcattatgttactgtcttca |
25963789 |
T |
 |
| Q |
101 |
tgagagtggtgttggatgcacaagaggagcatgtgattcaaaatgttgaacctgataagtgttatggttgggattggtttgaattggagaatttgccaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25963790 |
tgagagtggtgttggatgcacaagaggagcatgtgattcagaatgttgaacctgataagtgttatggttgggattggtttgaattggagaatttgccaaa |
25963889 |
T |
 |
| Q |
201 |
ccctttgttttggcctttggaaaagatgcttaaaggaggctttgatccttttccgagttgattctatgtattttaaatcattgacatgtagaagt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25963890 |
ccctttgttttggcctttggaaaagatgcttaaaggaggctttgatccttttctgaattgattatatgtattttaaatcattgacatgtagaagt |
25963984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University