View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11260_low_30 (Length: 238)
Name: NF11260_low_30
Description: NF11260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11260_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 3 - 134
Target Start/End: Original strand, 32467674 - 32467805
Alignment:
| Q |
3 |
tactcatgtgtctacaagaaagtttaaattttgcaagacaaggtgattcactaggcgaacagaagcgagctcagagcaaatgactctagacagttgtggg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| || |
|
|
| T |
32467674 |
tactcatgtgtctacaagaaagtttaaattttgcaagacaaggtgattcactaggcgaacagaagcaagctcggagcaaatgactctagacagttgtagg |
32467773 |
T |
|
| Q |
103 |
gatgatgaaagatcatattcgctagcaccata |
134 |
Q |
| |
|
||||||||||||||| ||||||||| |||||| |
|
|
| T |
32467774 |
gatgatgaaagatcaaattcgctagtaccata |
32467805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 154 - 224
Target Start/End: Original strand, 32468688 - 32468758
Alignment:
| Q |
154 |
tctcttcgggtacgctgctagtttgggttggcttgcctagccttagcttatctgggttgtcagccatatct |
224 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32468688 |
tctctttgggtacgctgctagtttgggttggcttgcctagccttagcttatctaggttgtcagccatatct |
32468758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University