View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11260_low_37 (Length: 204)

Name: NF11260_low_37
Description: NF11260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11260_low_37
NF11260_low_37
[»] chr8 (1 HSPs)
chr8 (1-187)||(8270022-8270208)


Alignment Details
Target: chr8 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 8270022 - 8270208
Alignment:
1 tttacaagattcacccttgaacctttatatcatgacatatgtttgttcatgttttctcaagtggctttacgtacgacaaatttgagatcttgttgtggag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
8270022 tttacaagattcacccttgaacctttatatcatgacatatgtttgttcatgttttctcaagtggctttacgtacgacaaatttgagatcttgctgtggag 8270121  T
101 tatgaagcaaagaattacaagattcattcttgggccaaatatgtgagatgtctattaaccattggatgagtgagtcaaccatgtttg 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8270122 tatgaagcaaagaattacaagattcattcttgggccaaatatgtgagatgtctattaaccattggatgagtgagtcaaccatgtttg 8270208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University