View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11260_low_37 (Length: 204)
Name: NF11260_low_37
Description: NF11260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11260_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 8270022 - 8270208
Alignment:
| Q |
1 |
tttacaagattcacccttgaacctttatatcatgacatatgtttgttcatgttttctcaagtggctttacgtacgacaaatttgagatcttgttgtggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8270022 |
tttacaagattcacccttgaacctttatatcatgacatatgtttgttcatgttttctcaagtggctttacgtacgacaaatttgagatcttgctgtggag |
8270121 |
T |
 |
| Q |
101 |
tatgaagcaaagaattacaagattcattcttgggccaaatatgtgagatgtctattaaccattggatgagtgagtcaaccatgtttg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8270122 |
tatgaagcaaagaattacaagattcattcttgggccaaatatgtgagatgtctattaaccattggatgagtgagtcaaccatgtttg |
8270208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University