View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11262_high_10 (Length: 254)
Name: NF11262_high_10
Description: NF11262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11262_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 10929252 - 10929014
Alignment:
| Q |
1 |
cacattctaagagtatcctaacagcctcgacattgccacaaaggatagcatggtgtagaatagttcttccacagtgacaactatttgagacatattgcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
10929252 |
cacattctaagagtatcctaacagcctcgacattgccacaaaggatagcatggtgtagaatagttcttccacagtgacaattatttgagacatgttgcag |
10929153 |
T |
|
| Q |
101 |
gagcaagcgtaatatagcaccacttttttcaaaatactcaactgcacaccaggtgatgccatatggttctcccagtccagcacccacacgaagttcttcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10929152 |
gagcaagcgtaatatagcaccacttttttcaaaatactcaactgcacaccaggtgatgccatatggttctcccagtccagcacccacacgaagttcttcg |
10929053 |
T |
|
| Q |
201 |
ccagttgcattatcccatgaccatgctccaagccttact |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10929052 |
ccagttgcattatcccatgaccatgctccaagccttact |
10929014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University