View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11262_high_12 (Length: 250)

Name: NF11262_high_12
Description: NF11262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11262_high_12
NF11262_high_12
[»] chr7 (1 HSPs)
chr7 (1-240)||(10929378-10929617)


Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 10929378 - 10929617
Alignment:
1 tctcgaacagactccggtgacacagctttgatggtttgtgcaaaatataaacaagaggagtgtctcaaagtactaacaagggctggtgctgattttggct 100  Q
    ||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
10929378 tctcgaacagactgcggtgacacagctttgatgatttgtgcaaaatataaacaagaggagtgtctcaaagtactaacaagggctggtgctgatttttgct 10929477  T
101 tggtgaacagtgcgggtcaatctgcaagttcaattgccgagtcgtacaagtggtcccatggttttcaacaagtagtggtggatgtaattagaaatggcaa 200  Q
    ||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
10929478 tggtgaacagtgcaggtcaatctgcaagttcaattgccgagtcatacaagtggtcccatggttttcaacaagcagtggtggatgtaattagaaatggcaa 10929577  T
201 gatacccaaatccagcaatacttctactttttcccctttg 240  Q
    ||||||||||||||||||||||||||||||||||||||||    
10929578 gatacccaaatccagcaatacttctactttttcccctttg 10929617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University