View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11262_high_14 (Length: 221)
Name: NF11262_high_14
Description: NF11262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11262_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 2523754 - 2523954
Alignment:
| Q |
1 |
tcacatcatataacttatgtttacaaaactacagtctagtaaaaatattggactattattttttatatatgtgttattnnnnnnnnnngggctcttaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2523754 |
tcacatcatataacttatgtttacaaaactacagtctagtaaaaatattggactattattttttatatatgtgttattaaaaaaaaa--ggctcttaaaa |
2523851 |
T |
 |
| Q |
101 |
tctctacaaattactgcatgcagttgcaccaatatattatgctgacctagctgctgctcagatagcacaatttataaaatatgatgagtcagagaatctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2523852 |
tctctacaaattactgcatgcagttgcaccaatatattatgctgacctagctgctgctcagatagcacaatttataaaatatgatgagtcagagaatctt |
2523951 |
T |
 |
| Q |
201 |
tcc |
203 |
Q |
| |
|
||| |
|
|
| T |
2523952 |
tcc |
2523954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University