View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11263_high_1 (Length: 267)
Name: NF11263_high_1
Description: NF11263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11263_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 10 - 106
Target Start/End: Complemental strand, 43062287 - 43062191
Alignment:
| Q |
10 |
gcacagaagcaagaagcaatgtgggaaagacagcatgagcttgctgccgataagattttctctatgtgctctgaccttggtggtttcttcctcaagg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062287 |
gcacagaagcaagaagcaatgtgggaaagacagcatgagcttgctgccgataagattttctctatgtgctctgaccttggtggtttcttcctcaagg |
43062191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 171 - 248
Target Start/End: Complemental strand, 43062126 - 43062049
Alignment:
| Q |
171 |
aactagttttgttgatttttgtattcagattgcacaaattattgggaagccggatttggcaccggctgcatgggtgaa |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062126 |
aactagttttgttgatttttgtattcagattgcacaaattattgggaagccggatttggcaccggctgcatgggtgaa |
43062049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University