View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11263_low_1 (Length: 267)

Name: NF11263_low_1
Description: NF11263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11263_low_1
NF11263_low_1
[»] chr4 (2 HSPs)
chr4 (10-106)||(43062191-43062287)
chr4 (171-248)||(43062049-43062126)


Alignment Details
Target: chr4 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 10 - 106
Target Start/End: Complemental strand, 43062287 - 43062191
Alignment:
10 gcacagaagcaagaagcaatgtgggaaagacagcatgagcttgctgccgataagattttctctatgtgctctgaccttggtggtttcttcctcaagg 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43062287 gcacagaagcaagaagcaatgtgggaaagacagcatgagcttgctgccgataagattttctctatgtgctctgaccttggtggtttcttcctcaagg 43062191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 171 - 248
Target Start/End: Complemental strand, 43062126 - 43062049
Alignment:
171 aactagttttgttgatttttgtattcagattgcacaaattattgggaagccggatttggcaccggctgcatgggtgaa 248  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43062126 aactagttttgttgatttttgtattcagattgcacaaattattgggaagccggatttggcaccggctgcatgggtgaa 43062049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University