View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11263_low_5 (Length: 229)
Name: NF11263_low_5
Description: NF11263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11263_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 29885277 - 29885488
Alignment:
| Q |
1 |
tgaagaaatgtaattcatatctgataaattttcttgttttccattactaagtttagttagacgtttgaaattttttataatgtaattcccttaccttcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29885277 |
tgaagaaatgtaattcatatctgataaattttcttgttttccattactaagtttagttagacgtttgaaattttttataatgtaattcccttaccttcac |
29885376 |
T |
|
| Q |
101 |
tcnnnnnnnnnngttgttggaaattttaactttattttaagtacctcacttcttagagagcctacttag-aatttctttatcatttttatatcgattaag |
199 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29885377 |
tc-tttttttttgttgttggaaattttaactttattttaagtacctcacttcttagagagcctacttagaaatttctttatcatttttatatcgattaag |
29885475 |
T |
|
| Q |
200 |
tcaacaatgatca |
212 |
Q |
| |
|
||||||||||||| |
|
|
| T |
29885476 |
tcaacaatgatca |
29885488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University